Journal Home
Search for

Volume 103, Issue 3, Pages 237-240 (December 2008)


View previous. 10 of 32 View next.

Quantitative fluorescent polymerase chain reaction to detect chromosomal anomalies in spontaneous abortion

Gang Zoua, Jing Zhangbc, Xing W. Libc, Lin Hebc, Guang HebcCorresponding Author Informationemail address, Tony DuanaCorresponding Author Informationemail address

Received 6 May 2008; received in revised form 20 July 2008; accepted 21 July 2008. published online 24 September 2008.

Abstract 

Objectives

To evaluate the value of short tandem repeats (microsatellites) in the study of numerical chromosomal anomalies in spontaneous abortion.

Method

Multiplex quantitative fluorescent polymerase chain reaction (QF-PCR) was carried out on 61 spontaneous abortion samples and 48 controls using microsatellite markers from 8 chromosomes where aneuploids are commonly found.

Results

Of the 61 samples, 65.6% were successfully karyotyped, and the call rate of the QF-PCR was 98.3%. The correspondence between PCR and karyotyping was 95%. The success rate of karyotyping in the inevitable abortion group was 79.6%, higher than for the missed abortion group (8.3%), P<0.001. The call rate of QF-PCR showed no difference between these 2 groups (100% vs 91.7%, P=0.197).

Conclusion

Microsatellite-based QF-PCR is a helpful and reliable tool to diagnose numerical chromosomal anomalies in spontaneous abortion. It also provides a diagnosis for necrotic tissue.

Article Outline

Abstract

1. Introduction

2. Materials and methods

3. Results

4. Discussion

Acknowledgment

References

Copyright

1. Introduction 

return to Article Outline

Early pregnancy losses (less than 12 weeks of gestation) affect 12%–15% of clinically recognized pregnancies and up to 60% of all conceptions [1]. Many factors can cause embryo loss, but it is well recognized that 50%–75% of early spontaneous abortions result from chromosomal abnormalities [2], [3], [4]. In particular, trisomy causes a large number of spontaneous abortions [5]. Women who have undergone one or more spontaneous abortions caused by aneuploidy are at increased risk for chromosomal abnormalities in future pregnancies [6].

Quantitative fluorescent polymerase chain reaction (QF-PCR), based on the analysis of microsatellite markers (short tandem repeats [STR]), is a new diagnostic pathway to detect numerical chromosomal anomaly. The aim of the present study was to assess whether the QF-PCR technique can serve as a complementary method in cytogenetic studies of spontaneous abortion.

2. Materials and methods 

return to Article Outline

Tissues from 61 early spontaneous abortions (at 6 to 12 weeks of gestation, mean age of the patients 30.4±4.2 years) were collected from the outpatient clinic of Shanghai First Maternity and Infant Hospital. If the static sonographic image of the embryo sac corresponded to the expected size according to the calculation based on the date of the woman's last menstrual period, it was defined as inevitable (fresh group) abortion, otherwise it was defined as missed spontaneous abortion (necrosis group). All tissues were handled according to the standard chorionic villus karyotyping procedure on the day of operation. Forty-eight blood samples from unrelated healthy persons (50% male) with a mean age of 35.2±5.44 years from Shanghai were used as controls. Informed consent was obtained from all the individuals tested, and all procedures were carried out with the approval of the local Experimentation Ethics Committee (Department of Obstetrics and Gynecology, Tongji University).

Seventeen microsatellite markers from 7 autosomes and 2 from sex chromosomes (X) were chosen from the literature or the website http://www.gdb.org (Table 1). All 7 chromosomes are most probably linked with numerical anomalies. One amelogenin gene marker [7] was used for differentiating gender. The forward primers were 5′-labeled with the fluorescent dye 6-carboxyfluorescein (FAM). Overall 8 multiplex PCR assays were designed (Table 1). PCR was performed in a total volume of 5 μL containing 10 ng of genomic DNA, 5 pmol of each primer, 2 mM MgCl2, 200 μM dNTPs and 0.25 units of Hotstar Taq (Qiagen; GmbH, Hilden, Germany) on a thermal cycler 9700 (Perkin-Elmer Applied Biosystems, Foster City, CA, USA) under a touchdown PCR procedure. All the samples that failed in the first amplification were included in a second procedure through a 10-μL volume system with all the amounts of inner reaction reagents doubled. One microlitre of PCR product was denatured and loaded onto MegaBACE1000 (Amersham Biosciences, Buckinghamshire, UK). The software Genetic Profiler was used for the genotyping of markers.

Table 1.

Primers used in multiplex PCR assays

Assay
Marker
Allele Length
Nuclei Repeats
Forward Primer
Reverse Primer
1D13S1740.188DI5′- FAM GACGACTAACCTCAAGTGCGTGAAGGCAGAAGTAAAACCATTATC
D14S800.132DI5′-FAM-CATCTACCTGCCGCAATAGCCAATTTATGGATACAACTT
2D14S2880.196DI5′-FAM-AGCTAGACTCTGCCATAAACATGGAGACAGGAACAACACAC
D15S1270.165DI5′-FAM-GGGGAACCTACACTTCCGCCAGGAATCTCAAATGGCTT
3D21S110.172–0.264TETRA5′-FAM-GTGAGTCAATTCCCCAAGGTTGTATTAGTCAATGTTCTCC
D18S11610.082DI5′-FAM-GTCCGTCCAACGTCCAAGGAGAGCCACACCTATCCTG
4D18S4740.124DI5′-FAM-TGGGGTGTTTACCAGCATCTGGCTTTCAATGTCAGAAGG
D21S12700.187TETRA5′-FAM-CCCACTGTATTATTCAGGGCACACACACACACACACATGC
5D13S1620.182–0.202DI5′-FAM-GCAATCTGAAACATTCTCCATTTCATCACAGATAATGCATGATAC
D13S1700.113–0.137DI5′-FAM-TTGCACTGTGGAGATAAACACATAGTCACATTGTCTTTTAAGGCAGGAG
D18S680.27–0.290DI5′-FAM-ATGGGAGACGTAATACACCCATGCTGCTGGTCTGAGG
6D15S10070.165DI5′-FAM-GGGGAACCTACACTTCCGCCAGGAATCTCAAATGGCTT
D22S11710.126DI5′-FAM-GAATCACCAGGATGGGCTCTAGAAGCATTGCCCCGTC
D21S14110.239TETRA5′-FAM-ATGATGAATGCATAGATGGATGAATGTGTGTCCTTCCAGGC
7D16S30170.189–0.197DI5′-FAM-TGTCTTATTGGAAGTGTCACCTCTACAGCCTCTGGCAAATGTT
D16S5390.157TETRA5′-FAM-GATCCCAAGCTCTTCCTCTTACGTTTGTGTGTGCATCTGT
D22S11570.233DI5′-FAM-ACCAGCCTGTAGTCCCACCAGCATAGAGCAGACATTT
8DXS80900.154DI5′-FAM-GGGTGAAATTCCATCACAAAACAAATGCAGATGTACAAAAAATA
DXS80940.225–0.239DI5′-FAM-GCCATTGTAAAATAAAATTCAGATGGTCTTGAGTCACTGTCT
AMXY⁎106, 110 5′-FAM-CCTGGGCTCTGTAAAGAATAGTGR-ATCAGAGCTTAAACTGGGAAGCTG

The number of the Assay column represents the STR markers combination in multiple PCR. In the Nuclei Repeats column, Di means dinucleotide, TETRA means tetranucleotide. AMXY⁎, also called Amelogenion gene, is not an STR but can be used to help differentiate gender.

The ratio of the fluorescent activity for 2 peaks in the PCR products of normal heterozygote (disomic diallelic) was expected to be 1:1. A few cases of disomic monoallelics only showed 1 peak. When referring to a trisomic patient, the STR markers can be detected either as 3 fluorescent peaks, 1:1:1 (complete heterozygote) or 2:1 (trisomic diallelic). The condition of all 3 alleles being coincidently homozygotic is rather rare and could be settled by choosing 2–4 or more markers. In practice, a phenomenon called preferred amplification occurs, meaning 1 of the 2 alleles is amplified first, which acts as a template in the later process, so the actual peak ratio of one disomic diallelic cell should be larger than 1:1 [8].

Genotyping data of the 48 normal control samples were combined to calculate heterozygosity (H) by the formula H=N[1−∑pi2]/(N−1) [9] (pi is the allele frequency, N is the number of samples) and the peak areas ratio of 2 alleles. The successful karyotyping outcome was used as a blind control to evaluate the diagnostic accuracy of the QF-PCR method. Differences between the success rates for the tests were compared using the test.

3. Results 

return to Article Outline

Forty of the 61 chorionic villus tissues of abortion samples (65.6%) were successfully karyotyped. Thirteen female fetuses (46,XX) and 11 male fetuses (46,XY) with normal chromosomes were detected. The abnormal karyotypes included 3 cases of trisomy 22; 2 of trisomy 45, XO; 2 trisomy 13; 2 trisomy 18; 2 trisomy 15; 1 trisomy 21; 1 trisomy 14; a 47,XXY; a triploidy; and a mosaicism 46,XX/46,XY. The success rates were 79.6% for the inevitable abortion group and 8.3% for the missed abortion group (P<0.001).

According to the genotyping of the 48 normal controls, we found that all of the 19 microsatellite markers had high heterozygosities. The genders of the 48 samples were correctly diagnosed by the 3-marker combination of AMXY, DXS8090, and DXS8094. According to the range of the peak areas ratio for the normal controls, we established that if 2 peaks of a PCR product were within the range of 1.0–1.8, it should be regarded as disomic diallelic, and if the product was found with 3 different peaks or a pattern of 2 peaks with a ratio of more than 1.85, it should be diagnosed as trisomic diallelic. Karyotyping and QF-PCR of a trisomy 15 are shown in Fig. 1.


View full-size image.

Figure 1. Karyotyping and QF-PCR results for an abortion trial. A trisomy 15 was detected by the two methods. The amplification of D15S1007 showed trio-peaks and the peak area ratio of D15S127 was 2.076 (over than 1.85), corresponding to the diagnosis of trisomy.


The QF-PCR call rate of 61 abortion samples was 98.3%. Only 1 sample failed after being amplified twice. Twenty-two samples were found to be numerically anomalous, accounting for 36.1% of the 61 samples. Only 2 cases showed a different outcome than the diagnoses of karyotyping, and the corresponding rate of PCR to karyotyping was 95.0% (59/61). In 1 case, the karyotyping result was 46 XX; the PCR presented irregular peaks after 2 amplifications. The PCR outcome of the other case resulted in normal male peaks, whereas the karyotyping showed a 46XY/46XX. The PCR success call rate was 100% in the inevitable abortion group and 91.7% in the missed abortion group (P=0.197).

4. Discussion 

return to Article Outline

Recently many authors have utilized STR-PCR in the prenatal examination of amniocentesis samples and in maternal plasma even after ectopic pregnancy [10], [11], [12], [13], but few have incorporated it in the study of spontaneous abortion material [14]. Most STRs have a high level of heterozygosis, and have a low rate of recombination, thus STR markers are widely used in forensic medicine and molecular laboratories [15], [16].

In our study, we selected 19 STRs with high heterozygosity to make sure that they were reliable for the diagnosis of chromosomal anomalies and set up diagnostic criteria of a trisomic diallelic sample with a peak ratio over 1.85 according to the data for the control group. The high diagnostic correspondence rate of 95% between QF-PCR and karyrotyping shows that the STR-PCR method is a reliable method that matches the classic cytogenetic method very well. However, we found that QF-PCR was incorrect for mosaicism. These discrepant results may be due to the percentage of mosaicism and the presence of only one of the two cell lines at a detectable level in the test material [17].

The higher successful PCR call rate in the missed abortion group demonstrates that the STR-PCR method can be used on stale tissues; karyotyping strictly requires fresh samples.

The amelogenin gene, with different length of introns, is a pair of alleles located around the kinetochore of the sex chromosome. The difference in the length of the amplified fragment allowed us to determine the gender of a genomic sample [7]. All 48 DNA samples from the controls were correctly diagnosed by the amelogenin gene amplification technique.

Autosomal trisomy accounts for most chromosomal numerical anomalies. It is estimated that chromosomes 15, 16, 14, and 22 are often involved in early spontaneous abortions affected by chromosomal anomalies, whereas chromosomes 13, 18, and 21 and the sex chromosomes are more commonly found in late spontaneous abortions, so the STR markers covering 7 autosomes and the sex chromosomes were chosen for our study [18]. Our cytogenetic findings did not suggest the numerical anomaly that occurred in other autosomes beyond those chosen, supporting the fact that the 19 STR markers and one amelogenin marker are suitable for the diagnoses of common chromosome anomalies with generally accepted high incidence of aneuploidies.

The classic cytogenetic technique has considerable disadvantages: a long laboratory cycle, labor intensive, and culture failure, especially when karyotyping necrotic tissues. Compared with the molecular method and other newly applied techniques such as fluorescence in situ hybridization, primed in situ labeling, and spectral karyotyping, the STR-based QF-PCR technique is regarded as a highly accurate, low cost, and rapid diagnostic method to detect chromosome numerical anomalies. Osborne et al. [19] established a QF-PCR system to detect chromosome aneuploidy from as few as 10 cells. This method provides us with a supplementary pathway to determine chromosomal anomalies [20]. Ogilvie [21] and Leung et al. [22] recently proposed replacing conventional prenatal cytogenetic analysis with QF-PCR after positive screening for Down syndrome.

However, the technique has limitations; it cannot offer a correct diagnosis for mosaicism, translocation and other small deletions, or duplications [23]. Therefore, the QF-PCR technique will remain a supplementary method to cytogenetic karyotyping for some time.

Acknowledgements 

return to Article Outline

This research was funded by Shanghai Science and Technology Commission (research grant serial number 044119654).

References 

return to Article Outline

[1]. [1]Edmonds DK, Lindsay KS, Miller JF, Williamson E, Wood PJ. Early embryonic mortality in women. Fertil Steril. 1982;38(4):447–453. MEDLINE

[2]. [2]Scotchie JG, Fritz MA. Early pregnancy loss. Postgrad Obstet Gynecol. 2006;26:1–7.

[3]. [3]Sánchez JM, Franzi L, Collia F, De Díaz SL, Panal M, Dubner M. Cytogenetic study of spontaneous abortions by transabdominal villus sampling and direct analysis of villi. Prenat Diagn. 1999;19(7):601–603. MEDLINE

[4]. [4]Philipp T, Philipp K, Reiner A, Beer F, Kalousek DK. Embryoscopic and cytogenetic analysis of 233 missed abortions: factors involved in the pathogenesis of developmental defects of early failed pregnancies. Hum Reprod. 2003;18:1724–1732. MEDLINE | CrossRef

[5]. [5]Kalousek DK, Pantzar T, Tsai M, Paradice B. Early spontaneous abortion: morphologic and karyotypic findings in 3912 cases. Birth Defects Orig Artic Ser. 1993;29(1):53–61. MEDLINE

[6]. [6]Bianco K, Caughey AB, Shaffer BL, Davis R, Norton ME. History of miscarriage and increased incidence of fetal aneuploidy in subsequent pregnancy. Obstet Gynecol. 2006;107(5):1098–1102. MEDLINE

[7]. [7]Ochshorn Y, Bar-Shira A, Jonish A, Yaron Y. Rapid prenatal diagnosis of aneuploidy for chromosomes 21, 18, 13, and X by quantitative fluorescence polymerase chain reaction. Fetal Diagn Ther. 2006;21(4):326–331. MEDLINE

[8]. [8]Adinolfi M, Pertl B, Sherlock J. Rapid detection of aneuploidies by microsatellite and the quantitative fluorescent polymerase chain reaction. Prenat Diagn. 1997;17:1299–1311. MEDLINE

[9]. [9]Shete S, Tiwari H, Elston RC. On estimating the heterozygosity and polymorphism information content value. Theor Popul Biol. 2000;57(3):265–271. MEDLINE | CrossRef

[10]. [10]Mann K, Donaghue C, Fox SP, Docherty Z, Ogilvie CM. Strategies for the rapid prenatal diagnosis of chromosome aneuploidy. Eur J Hum Genet. 2004;12(11):907–915. MEDLINE | CrossRef

[11]. [11]Stojilkovic-Mikic T, Mann K, Docherty Z, Mackie Ogilvie E. Maternal cell contamination of prenatal samples assessed by QF-PCR genotyping. Prenat Diagn. 2005;25(1):79–83. MEDLINE | CrossRef

[12]. [12]Verma L, Macdonald F, Leedham P, McConachie M, Dhanjal S, Hultén M. Rapid and simple prenatal DNA diagnosis of Down's syndrome. Lancet. 1998;352(9121):9–12. Abstract | Full Text | Full-Text PDF (90 KB) | CrossRef

[13]. [13]Goddijn M, van Stralen M, Schuring-Blom H, Redeker B, van Leeuwen L, Repping S, et al. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies. Gynecol Obstet Invest. 2005;60(3):139–144. MEDLINE

[14]. [14]Diego-Alvarez D, Garcia-Hoyos M, Trujillo MJ, Gonzalez-Gonzalez C, Rodriguez de Alba M, Ayuso C, et al. Application of quantitative fluorescent PCR with short tandem repeat markers to the study of aneuploidies in spontaneous miscarriages. Hum Reprod. 2005;20(5):1235–1243. MEDLINE | CrossRef

[15]. [15]Pearson CE, Eichler EE, Lorenzetti D, Kramer SF, Zoghbi HY, Nelson DL, et al. Interruptions in the triplet repeats of SCA1 and FRAXA reduce the propensity and complexity of slipped strand DNA (S-DNA) formation. Biochemistry. 1998;37(8):2701–2708.

[16]. [16]Schneider PM. Scientific standards for studies in forensic genetics. Forensic Sci Int. 2007;165(2-3):238–243. Abstract | Full Text | Full-Text PDF (132 KB) | CrossRef

[17]. [17]Mann K, Kabba M, Donaghue C, Hills A, Ogilvie CM. Analysis of a chromosomally mosaic placenta to assess the cell populations in dissociated chorionic villi: implications for QF-PCR aneuploidy testing. Prenat Diagn. 2007;27(3):287–289. MEDLINE | CrossRef

[18]. [18]Menasha J, Levy B, Hirschhorn K, Kardon NB. Incidence and spectrum of chromosome abnormalities in spontaneous abortions: new insights from a 12-year study. Genet Med. 2005;7(4):251–263. MEDLINE | CrossRef

[19]. [19]Osborne EC, Trounson AO, Cram DS. A QF-PCR system to detect chromosome 13 aneuploidy from as few as ten cells. Am J Med Genet A. 2005;134A(1):33–38. CrossRef

[20]. [20]Nicolini U, Lalatta F, Natacci F, Curcio C, Bui TH. The introduction of QF-PCR in prenatal diagnosis of fetal aneuploidies: time for reconsideration. Hum Reprod Update. 2004;10(6):541–548. MEDLINE | CrossRef

[21]. [21]Ogilvie CM. Prenatal diagnosis for chromosome abnormalities: past, present and future. Pathol Biol (Paris). 2003;51(3):156–160. MEDLINE | CrossRef

[22]. [22]Leung WC, Lau ET, Lao TT, Tang MH. Rapid aneuploidy screening (FISH or QF-PCR): the changing scene in prenatal diagnosis?. Expert Rev Mol Diagn. 2004;4(3):333–337. MEDLINE | CrossRef

[23]. [23]Litt M, Luty JA. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat with in the cardiac muscle actin gene. Am J Hum Genet. 1989;44(3):397–401. MEDLINE

a Shanghai First Maternity and Infant Hospital of Tongji University, Shanghai, China

b Bio-X Life Science Research Center, Shanghai Jiao Tong University, Shanghai, China

c Institutes of Biomedical Sciences, Fudan University, Shanghai, China

Corresponding Author InformationCorresponding authors. Duan is to be contacted at Shanghai First Maternity and Infant Hospital of Tongji University, 536 Changle Road, Shanghai 200040, China. Tel.: +86 21 54035206. He, Bio-X Center, Shanghai Jiao Tong University, Haoran Building, 1954 Huashan Road, Shanghai 200030, China. Tel.: +86 21 62822491.

PII: S0020-7292(08)00342-1

doi:10.1016/j.ijgo.2008.07.014


View previous. 10 of 32 View next.